Establishment of nucleic acid sequence-based amplification for detection of respiratory syncytial virus

doi:10.3969/j.issn.1673-8640.2016.03.004

Abstract

Abstract:

Objective To establish a nucleic acid sequence-based amplification （NASBA） to detect respiratory syncytial virus（RSV）. Methods According to the alignment results from the National Center for Biotechnology Information （NCBI） gene databank,the specific primers for RSV were designed by Primer 5 software. Throat swab samples being positive for RSV by immuno-fluorescence assay were collected,and the corresponding negative samples were as controls. Through optimizing the sample process and amplification system, NASBA for detecting RSV was established and compared to reverse transcription polymerase chain reaction （RT-PCR）. Results Direct freeze-thawing throat swab samples were optimal for the sample process,and the supernatant was as the target for detecting. The specific primers were added with T7 promoter sequence. NASBA could detect the standard RSV RNA at 2.81×10² copies/µL,but RT-PCR could only show blurry products even up to 2.81×10⁴ copies/µL,which indicated that the sensitivity of NASBA assay was 100 times at least higher than that of RT-PCR. NASBA could detect RSV RNA in all of the 7 throat swab samples,while they showed negative in samples,which were positive for other viruses（2 cases of influenza A virus,3 cases of parainfluenza virus and 1 case of adenovirus）and negative RSV samples （3 cases）. These results indicated that NASBA had high specificity. Conclusions The established NASBA is a highly specific,sensitive and time-saving method,overcoming the limitations of current detections for RSV. It is an effective method to detect RSV.

Key words: Respiratory syncytial virus, Nucleic acid sequence-based amplification, Methodology evaluation

CLC Number:

R446.1

YANG Haiou, YE Xingchen, FU Qihua. Establishment of nucleic acid sequence-based amplification for detection of respiratory syncytial virus[J]. Laboratory Medicine, 2016, 31(3): 168-172.

Figures/Tables 7

References 16

1	BECK ET,HENRICKSON KJ.Molecular diagnosis of respiratory viruses[J]. Future Microbiol,2010,5(6):901-916.
2	JARTTI T,SÖDERLUND-VENERMO M,HEDMAN K,et al. New molecular virus detection methods and their clinical value in lower respiratory tract infections in children[J]. Paediatr Respir Rev,2013,14(1):38-45.
3	RESCH B.Burden of respiratory syncytial virus infection in young children[J]. World J Clin Pediat,2012,1(3):8-12.
4	MAHONY JB,PETRICH A,SMIEJA M.Molecular diagnosis of respiratory virus infections[J]. Crit Rev Clin Lab Sci,2011,48(5-6):217-249.
5	SCHWARTZ RH,SELVARANGAN R,ZISSMAN EN.BD veritor system respiratory syncytial virus rapid antigen detection test:point-of-care results in primary care pediatric offices compared with reverse transcriptase polymerase chain reaction and viral culture methods[J]. Pediatr Emerg Care,2015,31(12):830-834.
6	MO QH,WANG HB,DAI HR,et al.Rapid and simultaneous detection of three major diarrhea-causing viruses by multiplex real-time nucleic acid sequence-based amplification[J]. Arch Virol,2015,160(3):719-725.
7	JITTMITTRAPHAP A,THAMMAPALO S,RATANASETYUTH N,et al.Rapid detection of dengue viral RNA in mosquitoes by nucleic acid-sequence based amplification (NASBA)[J]. Southeast Asian J Trop Med Public Health,2006,37(6):1117-1124.
8	LAU LT,FENG XY,LAM TY,et al.Development of multiplex nucleic acid sequence-based amplification for detection of human respiratory tract viruses[J]. J Virol Methods,2010,168(1-2):251-254.
9	WANG L,HE Y,XIA Y,et al.Retrospective comparison of nucleic acid sequence-based amplification,real-time PCR,and galactomannan test for diagnosis of invasive aspergillosis[J]. J Mol Diagn,2014,16(5):584-590.
10	COMPTON J.Nucleic acid sequence-based amplifica-tion[J]. Nature,1991,350(6313):91-92.
11	EDIN A,GRANHOLM S,KOSKINIEMI S,et al.Development and laboratory evaluation of a real-time PCR assay for detecting viruses and bacteria of relevance for community-acquired pneumonia[J]. J Mol Diagn,2015,17(3):315-324.
12	MERCIER-DELARUE S,VRAY M,PLANTIER JC,et al.Higher specificity of nucleic acid sequence-based amplification isothermal technology than of real-time PCR for quantification of HIV-1 RNA on dried blood spots[J]. J Clin Microbiol,2014,52(1):52-56.
13	MO QH,WANG HB,TAN H,et al.Comparative detection of rotavirus RNA by conventional RT-PCR,TaqMan RT-PCR and real-time nucleic acid sequence-based amplification[J]. J Virol Methods,2015,213:1-4.
14	WANG J,TAI W,ANGIONE SL,et al.Subtyping clinical specimens of influenza A virus by use of a simple method to amplify RNA targets[J]. J Clin Microbiol,2013,51(10):3324-3330.
15	TAWAR RG,DUQUERROY S,VONRHEIN C,et al.Crystal structure of a nucleocapsid-like nucleoprotein-RNA complex of respiratory syncytial virus[J]. Science,2009,326(5957):1279-1283.
16	MONEY VA,MCPHEE HK,MOSELY JA,et al.Surface features of a Mononegavirales matrix protein indicate sites of membrane interaction[J]. Proc Natl Acad Sci U S A,2009,106(11):4441-4446.

名称	序列（5′~3′）
F端	AATTCTAATACGACTCACTATAGGGAGAAGGAAAGTCCTACAAAAAAATGC
R端	AATTCTAATACGACTCACTATAGGGAGAAGGATCTATCTCCTGCTGCTAAT

名称	序列（5′~3′）
F端	AATTCTAATACGACTCACTATAGGGAGAAGGAAAGTCCTACAAAAAAATGC
R端	AATTCTAATACGACTCACTATAGGGAGAAGGATCTATCTCCTGCTGCTAAT

[1]	WANG Juan, LIAO Huanjin, LI Yanning, GE Yiqin, LI Jia. RSV infection of air-liquid interface cultured human bronchial epithelial cell and its effect on HMGB1 and pMLKL expressions [J]. Laboratory Medicine, 2022, 37(2): 177-182.
[2]	YUE Xiaojing, LI Wei, LI Pingfa. Determination of paraquat in plasma by HPLC-MS/MS [J]. Laboratory Medicine, 2018, 33(2): 132-138.
[3]	ZHU Gengchao, LI Shuxiang, YANG Chen. Determination of respiratory tract virus among children in Suzhou from 2011 to 2015 [J]. Laboratory Medicine, 2017, 32(9): 779-783.
[4]	JIA Keke, QIN Yanfei, YANG Shuo, ZHANG Jie. Comparison between a lipoprotein （a） particle concentration assay and 2 kinds of lipoprotein （a） mass concentration assays [J]. Laboratory Medicine, 2017, 32(7): 570-576.
[5]	JIN Lilan, CAI Gang, LIN Lin, WANG Xianghui. Taqman-MGB method for determining CYP3A5 rs776746 site SNP and the influence of this site on the metabolism of tacrolimus [J]. Laboratory Medicine, 2015, 30(8): 830-834.
[6]	SUN Li, NIU Guoping. Evaluation and clinical application of latex-enhanced immunoturbidimetric assay for the detection of plasma neutrophil gelatinase-associated lipocalin [J]. Laboratory Medicine, 2015, 30(7): 734-739.
[7]	LU Gang, GAO Shejun, JU Yingbo.. Methodology evaluation and biological variation research of enzymatic colorimetric assay for the determination of serum free fatty acid [J]. , 2014, 29(2): 143-147.
[8]	WU Lei, YANG Yang, TANG Zhenhua, ZHANG Qiangqiang, LU Tingyan, JIN Yuelan, HU Weizhong, XU Ming, GU Weiming. Evaluation of an improved immuno-chromatographic assay to detect chlamydia trachomatis in genitourinary tract infection [J]. , 2014, 29(12): 1226-1229.
[9]	ZHANG Xueqing,HU Jun,NING Xiaoxiao,GAO Shufang,WANG Lei. Analysis on the detection situation of 7 common viruses in 2 425 children with respiratory tract infection [J]. , 2013, 28(7): 602-605.
[10]	LOU Yiqun,CHU Wei,SONG Lili,WANG Yu,LAO Baofa.. A strain of RSV-A isolated from the monitoring specimens of avian influenza A (H7N9) virus [J]. , 2013, 28(12): 1137-1139.
[11]	YU Fei;LI Meng;CAO Bo. Evaluation on the methodology of blood manganese determination by inductively coupled plasma atomic emission spectrometry [J]. , 2012, 27(7): 561-563.
[12]	XING Xiaoguang. Evaluation on the homocysteine detection by enzyme transition method and the early diagnostic significance of homocysteine to coronary heart disease [J]. , 2012, 27(7): 571-574.
[13]	GAO Ling;FENG Pinning;YU Xiongwen;YAO Zhenrong;LI Songlin. The observation of imprecision and linearity on detection of pepsinogen Ⅱby latexenhanced immunoturbidimetry assay [J]. , 2012, 27(2): 122-125.
[14]	ZENG Fangyin 1，ZHANG Yuming 2，ZHANG Peng 1，LIN Li 3，SUN Dehua 1. Methodology evaluation of particle-enhanced turbidimetric immunoassay for determining alpha-fetoprotein [J]. , 2012, 27(11): 896-899.
[15]	ZHU Xiaohua;CHENG Liming;ZHU Yaowu;GUAN Qing. Methodology evaluation of liquid immune colloidal gold technique in the determination of plasma cystatin C [J]. , 2010, 25(03): 214-218.