Establishment of fluorescence quantitation PCR to amplify human adenovirus-B55

doi:10.3969/j.issn.1673-8640.2019.03.016

Laboratory Medicine ›› 2019, Vol. 34 ›› Issue (3): 259-262.DOI: 10.3969/j.issn.1673-8640.2019.03.016

Previous Articles Next Articles

Establishment of fluorescence quantitation PCR to amplify human adenovirus-B55

DONG Lei¹, LIU Juan², AI Xianyin³, MA Hongyu¹, QUAN Shouzhen¹, JIANG Tao⁴

1. Clinical Laboratory Center,the General Hospital of Peoples' Liberation Army Air Force,Beijing 100142,China
2. Department of Blood Transfusion,the General Hospital of Peoples' Liberation Army Air Force,Beijing 100142,China
3. Army Health Company 32143 of Chinese People's Liberation Army, Xinyang 464000, Henan,China
4. Beijing Institute of Microbiology and Epidemiology,State Key Laboratory of Pathogen and Biosecurity,Beijing 100071,China

Received:2018-01-10 Online:2019-03-30 Published:2019-03-27

Abstract

Abstract:

Objective To establish real-time fluorescence quantitation polymerase chain reaction （PCR）to amplify human adenovirus（HAdV）-B55,and to verify its performance. Methods The specific primers for the Hexon sequence of HAdV-B55 were designed with Beacon Designer 7 software,and the real-time fluorescence quantitation PCR was established. The sensitivity and specificity were evaluated. Results The specific primers for HAdV-B55 were obtained,and the real-time fluorescence quantitation PCR for HAdV-B55 had been established. The sensitivity was 0.08 PFU/reaction,and the specificity was good. There was no cross reaction with HAdVB Conclusions The real-time fluorescence quantitation PCR to detect HAdV-B55 has been established,which lays the foundation for the rapid detection and prevention of HAdV-B55.

Key words: Human adenovirus, Real-time fluorescence quantitation polymerase chain reaction, Rapid detection

CLC Number:

R446.1

DONG Lei, LIU Juan, AI Xianyin, MA Hongyu, QUAN Shouzhen, JIANG Tao. Establishment of fluorescence quantitation PCR to amplify human adenovirus-B55[J]. Laboratory Medicine, 2019, 34(3): 259-262.

Figures/Tables 4

References 8

[1]	SMITH J G,WIETHOFF C M,STEWART P L, et al.Adenovirus[J]. Curr Top Microbiol Immunol, 2010, 343: 195-224.
[2]	KAJON A E, DICKSON L M, METZGAR D, et al.Outbreak of febrile respiratory illness associated with adenovirus 11a infection in a Singapore military training cAMP[J]. J Clin Microbiol, 2010, 48(4): 1438-1441.
[3]	CHMIELEWICZ B, BENZLER J, PAULI G, et al.Respiratory disease caused by a species B2 adenovirus in a military camp in Turkey[J]. J Med Virol, 2005,77(2): 232-237.
[4]	LU Q B, TONG Y G, WO Y, et al.Epidemiology of human adenovirus and molecular characterization of human adenovirus 55 in China, 2009-2012[J]. Influenza Other Respir Viruses, 2014, 8(3): 302-308.
[5]	LIU J, NIAN Q G, ZHANG Y, et al.In vitro characterization of human adenovirus type 55 in comparison with its parental adenoviruses, types 11 and 14[J]. PLoS One, 2014,9(6):e100665.
[6]	ZHU Z, ZHANG Y, XU S, et al.Outbreak of acute respiratory disease in China caused by B2 species of adenovirus type 11[J]. J Clin Microbiol,2009,47(3): 697-703.
[7]	BOLOTIN S,ROBERTSONB A V,ESHAGHI A,et al.Development of a novel real-time reverse-transcriptase PCR method for the detection of H275Y positive influenza A H1N1 isolates[J]. J Virol Methods, 2009, 158(1-2): 190-194.
[8]	CARR M J, SAYRE N, DUFFY M.Rapid molecular detection of the H275Y oseltamivir resistance gene mutation in circulating influenza A (H1N1) viruses[J]. J Virol Methods, 2008, 153(2): 257-262.

引物名称	引物序列（5'~3'）	长度（bp）
ADV55-Hexon-423F1	CTCAGTGGATTGCAGAAG	18
ADV55-Hexon-423R1	CAGCATAAATCGGTTTACTTTC	22
ADV55-Hexon-423Pro	FAM-AAATGGTGAGGAGCGC1GTAACA-TAMRA	22

引物名称	引物序列（5'~3'）	长度（bp）
ADV55-Hexon-423F1	CTCAGTGGATTGCAGAAG	18
ADV55-Hexon-423R1	CAGCATAAATCGGTTTACTTTC	22
ADV55-Hexon-423Pro	FAM-AAATGGTGAGGAGCGC1GTAACA-TAMRA	22

[1]	HOU Weiwei, JIANG Lian, LI Dong. Clinical application of matrix-assisted laser desorption ionization time-of-flight mass spectrometry in the direct detection of blood culture positive specimens [J]. Laboratory Medicine, 2021, 36(4): 424-429.
[2]	GAO Juyi, WU Chuanan, YANG Weikang, LUO Yuxuan, LIU Shengnan, XU Xiaoping. Role of COP microfluidic chip for the rapid detection of Escherichia coli O157:H7 [J]. Laboratory Medicine, 2020, 35(2): 148-152.
[3]	WU Xinglong, ZHAO Xiangwen, ZHAO Qingling. Application of resazurin reduction-based assay for the rapid detection of polymyxin B drug susceptibility in vitro in Acinetobacter baumannii and Pseudomonas aeruginosa [J]. Laboratory Medicine, 2019, 34(9): 812-814.
[4]	DUAN Feiyun, CHEN Xiaoming, CHEN Ran. Etiological analysis of children with hand,foot and mouth disease in Dali Prefecture from 2013 to 2017 [J]. Laboratory Medicine, 2019, 34(7): 583-586.
[5]	WANG Chongyi, SHI Xunzhong, SUN Zhenglin. Real-time fluorescence quantitation polymerase chain reaction for Neisseria meningitidis determination [J]. Laboratory Medicine, 2018, 33(4): 339-342.
[6]	SU Qian, CHEN Wenju, WANG Pan, LI Zhaoyun. Combined determination of serum miR-598-3p and CA153 in the diagnosis of breast carcinoma [J]. Laboratory Medicine, 2017, 32(6): 457-460.
[7]	CHEN Bin, YANG Yinmei, ZHONG Zhimin, LEI Xiuxia, LIU Dayu, XU Banglao. Establishment and application of real-time fluorescence LAMP for the detection of NDM-1-positive bacteria [J]. Laboratory Medicine, 2016, 31(8): 688-693.
[8]	YU Ying, WANG Wenjing, LU Ye. Research on a quantitative method to detect viable Salmonella by PMA-qPCR in livestock and poultry meat [J]. Laboratory Medicine, 2015, 30(5): 500-506.
[9]	ZHANG Guanghui, CAO Xueping, YU Jing, LIU Ying, GE Yan. Epidemiology and resistance mechanism study of carbapenem-resistant Acinetobacter baumannii [J]. Laboratory Medicine, 2015, 30(1): 53-57.
[10]	QIAO Yun,ZHAO Yingmei,ZHONG Jun,ZHANG Jue,GONG Jiewen. Application and evaluation of real-time fluorescence quantitation PCR in rapid determination of methicillin-resistant Staphylococcus aureus [J]. , 2014, 29(7): 745-749.
[11]	CHEN Xu, DONG Danfeng, HAN Lizhong, NI Yuxing. Clinical evaluation of GeneXpert real-time fluorescence quantitation PCR in rapid detection of Clostridium difficile [J]. , 2014, 29(6): 590-592.
[12]	YAN Shanhuo，SUN Lei，FU Kepeng，ZHUO Yongguang，YANG Shanye，FAN Zuqian，HUANG Yongxia. Rapid detection of Streptococcus pneumoniae by real-time fluorescence quantitation PCR [J]. , 2013, 28(3): 221-224.

Establishment of fluorescence quantitation PCR to amplify human adenovirus-B55

RichHTML

PDF (PC)

Knowledge

Abstract

Cite this article

share this article

Figures/Tables 4

References 8

Related Articles 12

Recommended Articles

Metrics